Circular RNA Explorer

miRNA Predictions
TargetScan miRNA predictions
CircRNA

Mirbase ID
CircRNA (Top) - miRNA (Bottom) pairing Site Type CircRNA Start CircRNA End 3' pairing local AU position TA SPS context+ score context+ score percentile
hsa_circ_0004771 (5' ... 3')

hsa-miR-1200 (3' ... 5')
 UAUUUCAGAACUGUUCUCAGGAC
     ||||||     ||||||| 
CUCCGAGUCUUACC--GAGUCCUC
7mer-m8 36 42 -0.053 -0.061 -0.057 0.022 -0.036 -0.305 98
hsa_circ_0004771 (5' ... 3')

hsa-miR-1203 (3' ... 5')
 CAGGGAAUCUGAAGACUCCGGAU
                ||||||  
  CUCGACGUAGGACCGAGGCCC 
7mer-1a 119 125 -0.002 0.011 -0.041 -0.064 -0.081 -0.251 78
hsa_circ_0004771 (5' ... 3')

hsa-miR-1253 (3' ... 5')
   CUACUUUUCAACAGCCUUCUCAA
                  ||||||  
    ACGUCCGACUAGAAGAAGAGA 
7mer-1a 152 158 0.008 -0.010 -0.045 0.021 -0.000 -0.1 91
hsa_circ_0004771 (5' ... 3')

hsa-miR-149 (3' ... 5')
 AUUUGGGAGAAACACAGCCAGAA
        |||     ||||||  
CCCUCACUUCUGUGCCUCGGUCU 
7mer-1a 72 78 -0.006 -0.005 -0.042 0.016 -0.063 -0.174 88
hsa_circ_0004771 (5' ... 3')

hsa-miR-515-5p (3' ... 5')
  GCAGAGGCUCAGAGCUUGGAGAC
        |||      ||||||| 
GUCUUUCACGAAAGAA-AACCUCUU
7mer-m8 191 197 -0.016 0.081 -0.061 0.023 -0.001 -0.094 78
hsa_circ_0004771 (5' ... 3')

hsa-miR-532-3p (3' ... 5')
 CAUUAUUUUAACAUUUGGGAGAA
                ||||||  
 ACGUUCGGAACCCACACCCUCC 
7mer-1a 60 66 0.001 -0.021 -0.044 0.023 -0.065 -0.18 93
hsa_circ_0004771 (5' ... 3')

hsa-miR-562 (3' ... 5')
CCGGAUGACAUCAGAGCUACUUU
               ||||||| 
   CGUUUACCAUGUCGAUGAAA
7mer-m8 136 142 -0.007 -0.035 -0.053 -0.009 0.012 -0.212 97
hsa_circ_0004771 (5' ... 3')

hsa-miR-580 (3' ... 5')
   UACUUUUCAACAGCCUUCUCAAU
                  ||||||  
   GGAUUACUAAGUAGUAAGAGUU 
7mer-1a 153 159 -0.002 0.001 -0.045 0.015 0.019 -0.086 92
hsa_circ_0004771 (5' ... 3')

hsa-miR-589 (3' ... 5')
AGCUAUUUCAGAACU-GUUCUCAG
        ||||    ||||||  
 GAGUCUCGUCUGCACCAAGAGU 
7mer-1a 33 39 -0.009 0.010 -0.047 -0.004 -0.004 -0.128 91
hsa_circ_0004771 (5' ... 3')

hsa-miR-595 (3' ... 5')
CACAGCCAGAAGAUGCACACUUG
               ||||||| 
  UCUGUGUGGUGCCGUGUGAAG
7mer-m8 84 90 0.003 0.030 -0.050 -0.005 0.020 -0.122 93
hsa_circ_0004771 (5' ... 3')

hsa-miR-648 (3' ... 5')
ACACAGCCAGAAGAU-GCACACUU
      ||||      ||||||| 
     UGGUCACGGGACGUGUGAA
7mer-m8 83 89 -0.016 -0.026 -0.050 -0.020 -0.035 -0.267 97
hsa_circ_0004771 (5' ... 3')

hsa-miR-653 (3' ... 5')
ACAUCAGAGCUACUUUUCAACAG
     ||||      ||||||| 
 GUCAUCUCUAACA-AAGUUGUG
7mer-m8 143 149 -0.025 -0.008 -0.054 -0.005 0.053 -0.159 95
hsa_circ_0004771 (5' ... 3')

hsa-miR-924 (3' ... 5')
  AGGACAGGGAAUCUGAAGACUCC
                 ||||||| 
     CGUUCUGUAGUGUUCUGAGA
7mer-m8 115 121 -0.007 0.056 -0.050 -0.008 0.013 -0.116 85

Please contact our Webmaster with questions or comments.